Nanoprobes Home Celebrating 20 years of innovation!  Contact Us
Products Instructions Tech Help Applications References News About Us Jobs Links
View Cart     Email Updates

Updated: December 17, 2004

N A N O P R O B E S     E - N E W S

Vol. 5, No. 12          December 17, 2004


In this Issue:

This monthly newsletter is to inform you about techniques to improve your immunogold labeling, highlight interesting articles and novel applications of metal nanoparticles, and answer your questions. We hope you enjoy it and find it useful; as always, let us know if we can improve anything.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Gold Lipids and GoldEnhance: Presenting...Antigens!

The immunogenicity of antigens - or, how quickly and strongly an immune response is mounted against them - is a critical factor in vaccine delivery. While it has long been known that particulate antibodies are more immunogenic than those in solution, we have not known why. In the current Journal of Immunology, Brewer and co-workers use liposomes labeled with a Nanogold-labeled lipid, visualized with gold enhancement, to help find out.

Lipid vesicles were prepared from 1-monopalmitoyl glycerol, cholesterol, and dicetyl phosphate in the molar ratio 5:4:1. In some experiments the lipid envelopes of vesicles were radiolabeled by incorporation of [3H]cholesterol or opsonized by incorporation of fluorescein-labeled dihexadecanoyl-glycerophosphoethanolamine followed by treatment with mouse anti-FITC (Molecular Probes). Antigens (OVA and fluorescently labeled derivatives) were entrapped in lipid vesicles by repeated cycles of freezing and thawing. The effect of antigen size was investigated using vesicles of different sizes: these were selectively prepared by extrusion through decreasing pore size polycarbonate filters at 60°C using a thermobarrel extruder. Non-entrapped antigen was removed by ultracentrifugation (100,000 x g for 45 min). Protein concentrations of the vesicle suspensions were determined using a modified ninhydrin assay. The particle size of the resulting lipid vesicles were demonstrated to be routinely 560 ± 60 nm after extrusion through 800-nm pore size filters and 155 ± 10 nm after extrusion through 100-nm pore size filters. Lipid vesicles were postformation labeled with molecular gold linked to palmitic acid (Palmitoyl Nanogold; Nanoprobes, Yaphank, NY) to label only the outer envelope.

Macrophages were derived from bone marrow cells isolated from BALB/c or CBA/ca mice and cultured for 710 days in DMEM supplemented with 10% FCS, 5 % horse serum, 100 micrograms/ml penicillin, 100 micrograms/ml streptomycin, 1 mM sodium pyruvate, and 20 % L-929 conditioned medium (BMMo medium). Macrophages were incubated with soluble FITC-HRP and/or HRP-biotin prepared in lipid vesicles for 10 min, chased for 0 or 20 minutes at 37°C, then fixed for 1 hour on ice with 1 % glutaraldehyde in 200 mM PIPES/0.5 mM MgCl2 (pH 7.1). Macrophages were encapsulated in gelatin and infiltrated with 2.3 M sucrose/20 % polyvinyl pyrrolidone in PIPES/MgCl2. Samples were trimmed and frozen; sections prepared on a cryoultra-microtome, probed with rabbit anti-FITC antibody, rat anti-LAMP-1 monoclonal antibody, or mouse anti-biotin, and detected with appropriate 6, 12 or 18 nm colloidal gold-labeled secondary antibodies. To reveal 1.4 nm palmitoyl Nanogold labeling of the lipid vesicle membrane, macrophages were grown on Thermanox coverslips incubated with golden lipid vesicles for 10 min, then fixed immediately in 2.5% glutaraldehyde for 30 min at 37°C. Cells were washed in 50 mM glycine/PBS, then brought gradually into distilled water and gold enhanced for 5 min at 4°C. The cells were then routinely processed for transmission electron microscopy through 1 % aqueous OsO4 and 1 % aqueous uranyl acetate before dehydration in an ethanol series and embedding in Spurrs epoxy resin. 80 nm ultrathin sections were uranyl and lead stained before electron microscope imaging.

The smaller lipid vesicles were found to colocalize FITC-HRP (marked by 18 nm gold) with biotin-HRP (12 nm gold) in electron-dense compartments, while large lipid vesicles occupy electron transparent compartments which do not contain biotin-HRP; after a 20-min chase, the small lipid vesicles containing FITC-HRP occupied multivesicular LAMP-1 positive (marked by 6 nm gold) compartments, characteristic of classical peptide-loading compartments (MHC class II). In contrast, large lipid vesicles were found in LAMP-1-negative electron-transparent compartments. Endosomes formed by internalization of small and large golden lipid vesicles by bone marrow macrophages were also morphologically distinct: multiple small lipid vesicles could be identified in macrophage endosomes that appear spacious, while large lipid vesicles were taken up into single endosomes, and the membrane (identified by gold staining) appeared closely apposed to the endosome membrane. These results demonstrate that vesicle size modulates the efficiency of antigen presentation by murine macrophages, accompanied by a profound change in antigen trafficking: antigen prepared in large particles (560 nm) was delivered into early endosome-like, immature phagosomes, whereas smaller vesicles (155 nm) and soluble antigens localized rapidly to late endosomes/lysosomes. However, peptide/class II complexes could be detected in both compartments. Phagosomes formed on uptake of large vesicles recruit antigen-processing apparatus while retaining the characteristics of early endosomes. In contrast, smaller vesicles bypassed this compartment, appeared to go more rapidly to lysosomal compartments, and exhibit reduced antigen-presenting efficiency. It is concluded that the ability of phagocytosed, particulate antigen to target early phagosomes results in more efficient antigen presentation.

Reference:

Brewer, J. M.; Pollock, K. G.; Tetley, L., and Russell D. G.: Vesicle size influences the trafficking, processing, and presentation of antigens in lipid vesicles. J. Immunol., 15, 6143-6150 (2004).

More detailed protocol for vesicle formation:

Brewer, J. M.; Tetley, L.; Richmond, J.; Liew, F. Y, and Alexander, J.: Lipid vesicle size determines the Th1 or Th2 response to entrapped antigen. J. Immunol., 161, 4000-4007 (1998).

More information:

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

More Tips for Labeling Site Selection and Conjugate Separation

More from our technical support archive:

  • I'm labeling a protein with several amines. If I use Mono-Sulfo-NHS-Nanogold®, can I control which amine I label?

    Yes, you can usually label preferentially at the N-terminal amine, because it has a lower pKa than do the amino- side-chains on lysine residues. Literature values for the pKa of the terminal amine vary from 7.6 - 8.0 to 8.9, while pKa values for the lysine amino side-chain are variously reported from 9.3 - 9.5 to 10.5.

    Selective N-terminal amine labeling has been described for other reactions, including PEGylation (polyethylene glycol conjugation), biotinylation, and labeling peptides with the fluorophore 7-amino-4-methylcoumarin-3-acetic acid (AMCA).

    What this means is that if you select a pH comfortably below the pKa of the lysine residues, you will preferentially label at the N-terminal amine; we recommend labeling at about pH 7.5. If you wish to label at a lysine residue, you should either use a higher pH, or protect the N-terminal amine before labeling.

    References:

    • Natarajan, S. K.; Assadi, M., and Sadegh-Nasseri, S.: Stable peptide binding to MHC class II molecule is rapid and is determined by a receptive conformation shaped by prior association with low affinity peptides. J. Immunol., 162, 4030-4036 (1999).

    • Selo, I, Negroni, L, Creminon, C, Grassi, J., and Wal, J. M.: Preferential labeling of alpha-amino N-terminal groups in peptides by biotin: application to the detection of specific anti-peptide antibodies by enzyme immunoassays. J. Immunol. Meth., 199, 127-38 (1996).

  • When I separate a labeled conjugate by gel filtration, what size (volume) column should I use?

    With gel filtration, the critical quantity is the ratio of the injection volume (the size of the mixture you inject) to the column volume: the injection volume you inject into the column should be less than 5 % of the total column volume. Therefore, the column volume you need will be determined by the size of the sample that you are injecting. The lower the ratio of sample : column size, the better your resolution will be.

    The other factor to consider is that the smaller the column you use, generally the higher conjugate recoveries will be (less column volume for the sample to stick to, and the more concentrated fractions mean less loss if you need to concentrate them further). Therefore, if you can reduce the volume of your reaction mixture before injection so that you can use a smaller column, it will be to your benefit. A useful approach, that we use ourselves, is to concentrate the reaction mixture using membrane centrifuge concentrators (such as the Centricon series, available from Millipore) to concentrate the reaction mixtures to 0.8 mL or less before injection, then use a 50 x 0.66 cm column (volume ~17 mL) packed using bulk media. Pre-packed columns sometimes give higher resolution: the 30 x 1.0 cm columns, which have a volume of ~ 23 mL, are a good size for many separations, with an injection volume of 1.0 mL or less. Recovery will be easier, and often higher, from columns of this size than from larger ones.

    A selection guide and full discussion on how to select the right gel for your separation is available in an earlier article.

  • How much Nanogold® is there in your products?

    Nanogold conjugates are packaged at a concentration of 0.08 mg/mL of active protein (not including the mass of the Nanogold particle), and contain close to one Nanogold particle per conjugate protein molecule. The amount and concentration in each

    Conjugate biomolecule Molecular weight Amount per mL (nmol) Number per mL (gold particles / biomolecules)
    Antibodies - whole IgG 150,000 0.53 3.21 x 1014
    Antibodies - Fab' fragments 50,000 1.60 9.64 x 1014
    Streptavidin 60,000 1.33 8.03 x 1014

    Our Nanogold® labeling reagents are packaged in vials of either 6 nmol or 30 nmol. Nanogold has a molecular weight of about 15,000. Therefore, for Nanogold reagents that are sold in a pure form - Monoamino Nanogold, Positively Charged Nanogold, Negatively Charged Nanogold, and Nanogold (Non-Functional), these vials will contain about 0.09 mg (for the 6 nmol size) or 0.45 mg (30 nmol) respectively.

    Monomaleimido Nanogold and Mono-Sulfo-NHS-Nanogold are both lyophilized from buffer solution, and therefore, while the amount of Nanogold is the same, these products contain additional buffer salts. For Monomaleimido Nanogold, these salts will add 2.24 mg to the mass of each 6 nmol vial, or 11.20 mg to the mass of each 30 nmol portion; while for Monom-Sulfo-NHS-Nanogold, they will add 2.30 mg to the mass of 6 nmol (total material 2.39 mg), or 11.49 mg to the mass of 30 nmol (total material 11.94 mg).

    More information:

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

    Combined Undecagold and Fluorescently Labeled Oligonucleotides

    We are often asked about the preparation of FluoroNanogold conjugates with probes other than antibodies or streptavidin. While this is technically possible as long as you have two different sites to which to attach the two labels, you should also consider whether it will work in practice - i.e. whether you will avoid quenching the fluorescence with the gold particle. Gold particles are excellent acceptors for fluorescence resonance energy transfer, or FRET, and absorb strongly at the emission wavelengths of commonly used fluorophores.

    Powell, R. D.; Halsey, C. M. R., and Hainfeld, J. F.: Combined fluorescent and gold immunoprobes: Reagents and methods for correlative light and electron microscopy. Microsc. Res. Tech., 42, 2-12 (1998).

    In order for fluorescence to be retained, the fluorescent tag has to be positioned sufficiently far away from the gold particle that a significant fraction is emitted directly rather than lost through energy transfer; generally, this means that the separation between the two must be greater than the Frster distance (the distance at which 50 % of absorbed energy is lost through energy transfer, and 50 % emitted as fluorescence). For Nanogold and fluorescein, the Förster distance is between 6 and 7 nm. The structure of fluorescein Fab'-FluoroNanogold and the Förster relationship between gold-fluorophore separation and fluorescence are shown below.

    [Structure and Frster Energy Transfer for Fluorescein Fab'-FluoroNanogold] (38k)]

    (left) Structure of fluorescein Fab'-FluoroNanogold, showing the separate attachment of the Nanogold and fluorescein labels; (right) Effect of fluorophore-Nanogold separation on fluorescence, showing Schematic showing Förster distance.

    Well, what if you want to make FluoroNanogold probes out of smaller molecules, such as oligonucleotides? One solution is to use a smaller gold particle, which will have a shorter Förster distance and quench the fluorophore less. This approach was demonstrated by Dellaire and co-workers, who used (Undecagold as the electron microscopy marker in a novel combined fluorescent and gold-labeled double-stranded DNA probe, which binds selectively to fusion proteins of the DNA-binding proteins LacI and Tet-R that recognize specific operator sequences. Double-stranded oligonucleotides are attractive candidates for multiply labeled probes because they possess four distinct ends for functionalization, and their separation can be controlled by hybridization. Unlike single-stranded RNA and DNA aptamers, which bind extensively to DNA and RNA, the double-stranded probes were selective for proteins, and different probes could be used for the multiplexed detection of different targets.

    Combined fluorescent and gold probes were prepared by labeling one strand with Cy3 and the other with undecagold. Functionalized dsDNAoligos recognized by LacI were constructed from two 41 bp single-stranded oligonucleotides encoding the symmetrical Lac operator 19 bp core sequence O-Sym (18): O-Sym-1 (*gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (*agattcaagaaattgtgagcgctcacaattctggctcacgc), where * represents a 50 modification with biotin, Cy3 or a disulfide group linked via a (CH2)6 spacer; O-Sym-1 and 2 were resuspended to 200 mM and equal volumes of each were added to a 1/5 volume of 10 x annealing buffer (50 mM TrisHCl, pH 7.5, with 1 M NaCl and 0.2 mM EDTA). The mixture was boiled for 4 min at 90°C followed by slow equilibration to room temperature to allow annealing to produce a ~91 mM solution of the dsDNA O-Sym oligonucleotide. The O-Sym-1 / Cy3-O-Sym-2dsDNA oligo was treated with 0.04 M dithiothreitol (DTT) in 0.17 M Na2HPO4, pH 8.0) for 16 h at room temperature to cleave the disulfide bond. Thiol by-products and DTT were removed by gel filtration over a Sephadex NAP-5 column equilibrated with 20 mM Na2HPO4, 150 NaCl and 1 mM EDTA, pH 6.5 (conjugation buffer). The dsDNA oligo was further purified by 70% ethanol precipitation and repeated washes. The pellet was then resuspended in the conjugation buffer to a concentration of 100 mM, and 10 ml (1 nmol) of this solution was added to 10 nmol of Monomaleimido Undecagold in 1 ml conjugation buffer. The mixture was incubated at room temperature with stirring for 1 h, then at 4°C for 16 h. Functionalized dsDNA oligos were separated from excess undecagold by ethanol precipitation with excess salmon sperm DNA and repeated washes. The product was resuspended in 10 mM TrisHCl, 0.1 mM EDTA and 150 mM KCl, pH 7.5, to achieve a final oligo concentration of ~10 mM.

    For correlative microscopy, SK-N-SH cells were split the day before transfection and 2 x 105 cells were seeded at 105 cells/mL onto 18 mm square coverslips in 8 or 6 well plates. Next day, cells were transfected with 12 mg of pGD-Flag-Lac338 and pGD-TET-PML DNA alone or combined per well using Lipofectamine 2000. Twenty-four to thirty-six hours post transfection, cells were fixed in 12 % paraformaldehyde in PBS (5 minutes), permeabilized in 0.5 % Triton X-100 (5 minutes at room temperature (RT)). After several washes in PBS, cells were blocked for 20 min at RT with O-Sym Binding/Blocking (OSB) buffer (10 mM TrisHCl pH 7.5, 0.1 mM EDTA, 150 mM KCl, 600 mg/ml of sheared herring sperm DNA and 200 mg/mL BSA). Cells were immediately hybridized for 12 h at 37°C with the Cy and undecagold-labeled dsDNA O-Sym oligo alone or combined with dsDNA Tet-O oligo (labeled with either Cy5, biotin or both) in OSB buffer at a concentration of 50100 nM. Coverslips were washed three times with PBS and mounted in anti-fade reagent for immediate immunofluorescence detection. For electron spectroscopic observation, the cells were post-fixed in 8 % paraformaldehyde and 2 % glutaraldehyde for 5 minutes at RT after labeling, then silver enhanced for 30 min at room temperature using a silver enhancement kit for LM or EM (Electron Microscopy Sciences). EM enhancement was performed 3 times, using fresh enhancement solution each time. Cells were then dehydrated in a series of graded ethanol washes (30, 50, 70 and 95 %) before Quetol 651 resin (EM Science) infiltration, curing and sectioning.

    Images of cells of interest were collected by both fluorescence microscopy, and by electron spectroscopic imaging, preferred for its superior distinction of nucleotides and proteins, using a Tecnai 20 TEM (FEI) at 200 kV, equipped with an imaging spectrometer (Gatan). Elemental maps were generated by dividing the element-enhanced post-edge image by the pre-edge image following alignment by cross-correlation; net ratio elemental maps were derived from pre- and post-edge images recorded at 120 and 155 eV (LII,III edge) for phosphorus, and at 385 and 415 eV (K edge) for nitrogen.

    This probe could be used specifically for multiple labeling in the presence of a functionalized dsDNA oligo recognized by TetR, constructed from the41 bp oligonucleotides Tet-O-1 (*tcgagtttactccctatcagtgatagagaacgtatgtcgcc) and Tet-O-2 (*ggcgacatacgttctctatcactgatagggagtaaactcgt) (where * is a 50 modification with either biotin or Cy5). Using the fluorescent and the combined fluorescent and gold-labeled dsDNA oligonucleotide, the authors localized within the nucleus a TetR-PML fusion protein within promyelocytic leukaemia protein (PML) bodies by LM, and a LacI-SC35 fusion protein within nuclear speckles by correlative light and electron microscopy (LM/EM).

    Reference:

    Dellaire, G.; Nisman, R.; Eskiw, C. H., and Bazett-Jones, D. P.: In situ imaging and isolation of proteins using dsDNA oligonucleotides. Nucleic Acids Res., 32, e165 (2004)

    More information:

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

    Nanogold Labeling of Plant Tissues

    Preparing plant tissues for immunogold labeling is challenging because of the difficulties in permeabilization. York-Dieter Stierhof, Sakiko Okumoto and co-workers report some successful methods in their recent article in the Journal of Experimental Botany: they used a Nanogold-labeled antibody with silver enhancement to detect promoter-reporter gene fusions and thus determine the spatial distribution of the Amino Acid Permease (AAP) family member AtAAP3 in Arabidopsis root tissue, as part of their studies on the uptake and distribution of amino acids.

    Roots of c-MycAAP3-expressing tobacco plants were embedded in 5 % low melting temperature agarose. Blocks were microtome sectioned (~100 micrometers). Sections were fixed immediately in 3 % formaldehyde in PBS for 30 min on ice, washed three times with PBS (58 mM Na2HPO4, 15 mM NaH2PO4, 68 mM NaCl, pH 7.4, and 6.7 mM EGTA), and labeled with mouse monoclonal anti-c-Myc antibody overnight at 4°C. The first antibody was visualized by either FITC-conjugated goat anti-mouse or Cy3-conjugated goat anti-mouse antibodies.

    Whole mount immunodetection on Arabidopsis roots was performed essentially as described in Lauber et al. (reference below). Roots were fixed in 4 % paraformaldehyde in PBS (137 mM NaCl, 8.1 mM Na2HPO4, 2.68 mM KCl, and 1.47 mM KH2PO4) at room temperature under vacuum for 1 h, then squashed onto gelatine-coated microscopic slides. Coverslips were removed after dipping the slides into liquid nitrogen. After drying for at least 15 min, specimens were rehydrated for 10 min. Cell walls were partially digested with 2 % (wt/vol) driselase for 30 minutes, and the plasma membrane was permeabilized with 0.5 or 3 % Nonident P40 in 10 % DMSO-MTSB (50 mM Pipes, 5 mM EGTA, 5 mM MgSO 4, pH 6.97.0) for ~1 hour. Non-specific interactions were blocked with 1 % (wt/vol) BSA in MTSB overnight at 4°C, and antibodies were diluted in 3% (wt/vol) BSA in MTSB and incubated at 37°C for ~3 hours.

    For thin cryosection labeling, root tips were fixed with 4 % formaldehyde in MSB for 30 min, followed by fixation with 8 % formaldehyde in MSB for 45 minutes on ice. Fixed root tips were embedded in 10 % gelatine; gelatine blocks containing root tips were infiltrated in 2.1 M sucrose in PBS, pH 7.2, and frozen in liquid nitrogen. Ultrathin (100 nm) and semithick cryosections (300 nm) were obtained using a cryo-ultramicrotome at -100°C and -80°C, respectively. Thawed cryosections were incubated with monoclonal anti-c-Myc antibody (1:100) in blocking buffer (1 % milk powder, 0.5 % BSA, in PBS) for 60 min. After washing with blocking buffer, bound antibodies were detected with Cy3-conjugated goat anti-mouse antibody or Nanogold-labeled goat anti-mouse IgG followed by silver enhancement. Final embedding was done in 2 % methyl cellulose for transmission electron microscopy, or in Mowiol 4.88 for immunofluorescence microscopy.

    Immunolocalization using Arabidopsis and tobacco plants expressing c-MycAAP3 revealed that AAP3 is mainly localized at the plasma membrane. The c-MycAAP3 protein was also localized in intracellular organelles and immunoelectron microscopy showed gold labeling on nuclear membrane, ER, Golgi, and multivesicular body-like vesicles. The potential role of AtAAP3 in root phloem was analyzed using insertion mutants: homozygous aap3-1 and aap3-2 mutants showed no effects in response to alterations in nitrogen nutrition, and did not behave differently from the wild type. Within the AAP family, AAP2, AAP5, and AAP6 have also been found to be expressed in roots, and may compensate for the loss of AAP3 activity in the mutants. While not elucidating its specific role, these studies support the involvement of AAP3 in amino acid transport.

    References:

    More information:

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

    Custom Synthesis at Nanoprobes

    Although our custom synthesis capabilities have been restricted in recent months, we are now able to offer custom Nanogold® labeling of antibodies, both IgG and, provided you can supply F(ab')2 fragments, Fab' fragments. We will be glad to consider other requests, but please keep in mind the following guidelines:

    • Antibodies or other molecules to be labeled must be supplied in a pure form, preferably affinity purified; we do not separate antibodies or proteins from molecules of similar size.

    • The more information you can provide about your antibody or other molecule, the more easily we can determine whether the request is feasible. In particular, it is helpful to know:
      • Molecular weight;
      • Solubility (pH, buffers, and organic solvent compatibility);
      • Which cross-linkable groups are available (thiols, i.e. cysteine residues, and amines, i.e. N-terminal or lysine residues); and
      • Is the functional group unique? If not, how many are available?

    • Prices do not include verification or testing of products unless this is specified in the original quotation.

    More information:

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

    Other Recent Publications

    Muly and co-workers add to the growing body of expertise in double labeling with silver-enhanced Nanogold and DAB with their recent report in Cerebral Cortex.. A pre-embedding immunogold/DAB protocol was used: Nanogold with silver enhancement was used to label parvalbumin (PV) or spinophilin, and subsequently, neurabin was labeled with DAB. Sections from juvenile macacque monkey brains were incubated overnight in a cocktail of primary immunoreagents (guinea pig anti-neurabin, 1:4000; and either mouse anti-PV, 1:10 000, or rabbit anti-spinophilin, 1:10 000), then incubated for 1 h in a cocktail of secondary antisera (biotinylated donkey anti-guinea pig, 1:200; and either Nanogold-conjugated goat anti-mouse antibody, or Nanogold goat anti-rabbit IgG, both used at 1:200 dilution). The sections were then silver-intensified and gold toned. Following this, the sections were incubated in ABC reagent and reacted with DAB; staining was then observed by electron microscopy.

    References:

    • Muly, E. C.; Allen, P.; Mazloom, M.; Aranbayeva, Z.; Greenfield, A. T., and Greengard, P.: Subcellular distribution of neurabin immunolabeling in primate prefrontal cortex: comparison with spinophilin. Cereb. Cortex., 14, 1398-1407 (2004).

    • Muly, E. C. III; Szigeti, K., and Goldman-Rakic, P. S.: D1 receptor in interneurons of macaque prefrontal cortex: distribution and subcellular localization. J Neurosci., 18, 10553-10565 (1998).

    Amplification method of the month is described by Dirks and Pierce, who describe triggered amplification by hybridization chain reaction (HCR) in their paper in the Proceedings of the National Academy of Sciences of the USA. In this approach, stable DNA monomers assemble only upon exposure to a target DNA fragment; the simplest incarnation uses two stable species of DNA hairpins which coexist in solution, until the introduction of initiator strands triggers a cascade of hybridization events that produces nicked double helices, analogous to alternating copolymers. The average molecular weight of the HCR products, determined by gel electrophoresis of products, varies inversely with initiator concentration. Amplification of other recognition events can be achieved by coupling HCR to aptamer triggers. This functionality allows DNA to act as an amplifying transducer for biosensing.

    Reference:

    Dirks, R. M., and Pierce, N. A.: Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. USA., 101, 15275-15278(2004).

    Gorm Danscher, one of the originators of the autometallographic technique, describes its application to the staining of zinc ions in this month's Journal of Histochemistry and Cytochemistry. The method reported is a modification of the Timm's immersion silver sulfide method, in which zinc ions are captured on zinc sulfide nanocrystals. One-, 2-, 4-, 12-, 16-, or 20-mm-thick tissue slices were immersed in a NeoTimm solution (NTS: 0.1 % sodium sulfide and 3 % glutaraldehyde in a 0.1 M Sørensen phosphate buffer, pH 7.4); the immersion jars were placed on a shaker and kept at 4°C. Three days later the slices were carefully rinsed twice in 0.1 M phosphate buffer for 10 min; if necessary, they can then be further developed by silver enhancement.

    Reference:

    Danscher, G.; Stoltenberg, M.; Bruhn, M.; Sondergaard, C.; and Jensen, D.: Immersion autometallography: histochemical in situ capturing of zinc ions in catalytic zinc-sulfur nanocrystals. J. Histochem. Cytochem., 521619-1625 (2004).

    In case you are interested, the Original Timm's method...

    Timm, F: Zur Histochemie der Schwermetalle. Das Sulfid-Silberverfahren. Dtsch. Z. Gerichtl. Med., 46, 706711 (1958).

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

     

  • Nanoprobes Home   Contact Us
    Products Instructions Tech Help Applications References News About Us Jobs at Nanoprobes Links
    View Cart     Email Updates
    © 1992-2011 Nanoprobes, Inc. All rights reserved. Sitemap